The effect of exosomal miR-1260a derived from human umbilical mesenchymal stem cells on apoptosis of granulosa cells in PCOS patients

doi:10.11958/20221070

Abstract

Abstract:

Objective To explore the effect of exosomal miR-1260a derived from human umbilical mesenchymal stem cells (hUC-MSCs) on apoptosis of granulosa cells (GCs) in polycystic ovary syndrome (PCOS) by targeting CASP8. Methods hUC-MSCs were obtained from the umbilical cord of healthy full-term fetus by tissue explants adherent method. The surface markers CD73 and CD90 were detected by flow cytometry. The hUC-MSCs- exosomes (exos) were extracted from the supernatant of hUC-MSCs, and the morphology was observed by transmission electron microscopy (TEM). The surface heat shock protein (HSP70) and tumor susceptibility gene 101 (TSG101) were detected by Western blot assay. Confocal microscope was used to observe whether PKH67 labeled hUC-MSCs-exos could be absorbed by GCs. Western blot assay was used to assess the protective effect of hUC-MSCs-exos on PCOS GCs. Clinical samples of GSE69909 were used for bioinformatics analysis. The differentially expressed miRNAs in hUC-MSCs-exos were obtained and verified by qPCR. miR-1260a mimics and negative control (NC) were synthesized and then transfected into KGN cells. Subsequently, cell apoptosis was measured by flow cytometry. Target genes of miR-1260a were predicted using Target Scan Human 7.2 database and verified by a dual-luciferase reporter gene assay. Expression levels of miR-1260a and CASP8 before and after uptake of hUC-MSCs-exos by PCOS GCs were detected by qPCR. Results The isolated cells accorded with the characteristics of hUC-MSCs. hUC-MSCs-exos were circular or elliptical membranous vesicle with diameter ranged from 30-150 nm and expressed the typical exosome markers HSP70 and TSG101. Confocal microscopy results showed that hUC-MSCs-exos could be absorbed by GCs. Compared with the control group, the expression of Cleaved-Caspase-8, Cleaved-Caspase-3 and Bax were significantly down-regulated and the expression of Bcl-2 was significantly up-regulated in the hUC-MSCs supernatant treated and the hUC-MSCs-exos treated groups (P<0.05). After GSE69909 database screening and qPCR verification, it was found that miR-1260a was enriched in hUC-MSCs-exos, and the overexpression of miR-1260a significantly inhibited the apoptosis of KGN cells (P<0.05). A dual-luciferase reporter gene assay showed that CASP8 was a direct target of miR-1260a. Moreover, the uptake of hUC-MSCs-exos by PCOS GCs increased the expression of miR-1260a and decreased the expression of CASP8 (P<0.05). Conclusion Our study reveals that exosomal miR-1260a derived from hUC-MSCs inhibits apoptosis of GCs in PCOS by targeting CASP8.

Key words: polycystic ovary syndrome, umbilical cord, mesenchymal stem cells, exosomes, granulosa cells, apoptosis, microRNAs, miR-1260a

CLC Number:

R711.75

Figures/Tables 9

Tab.1 Primer sequence of qPCR

基因名称	引物序列（5'→3'）	产物大小（bp）
miR-1260a	上游：AGATCCCACCTCTGCC 下游：AGTGCAGGGTCCGAGGTATT	64
U6	上游：TGGAACGCTTCACGAATTTGCG 下游：GGAACGATACAGAGAAGATTAGC	68
CASP8	上游：GCTAAATTCCACACTACC 下游：CTTGGGTTCAAGCAATC	114
β-actin	上游：CAGAGCAAGAGAGGCATCC 下游：CTGGGGTGTTGAAGGTCTC	217

Fig.1 Morphological observation and identification of hUC-MSCs and surface antigen markers

Fig.2 Identification of exosomes derived from hUC-MSCs and the uptake of exosomes by pGCs

Tab.2 Comparison of expression levels of Cleaved-Caspase-8, Cleaved-Caspase-3, Bax and Bcl-2 between the three groups of PCOS GCs

组别	Cleaved- Caspase-8	Cleaved- Caspase-3	Bax	Bcl-2
PBS对照组	1.26±0.15	2.19±0.13	1.64±0.04	0.29±0.11
hUC-MSCs上清液组	0.64±0.08^a	1.42±0.20^a	1.14±0.08^a	0.69±0.28^a
hUC-MSCs外泌体组	0.53±0.07^a	1.07±0.01^a	0.67±0.10^a	1.72±0.34^a
F	40.872^＊＊	51.686^＊＊	114.260^＊＊	23.807^＊＊

Fig.3 Effects of hUC-MSCs-exos on protein expression levels of Cleaved-Caspase-8, Cleaved-Caspase-3, Bax and Bcl-2 in PCOS granulosa cells

Fig.4 miR-1260a enriched in hUC-MSCs-exos

Fig.5 miR-1260a inhibited cell apoptosis of KGN cells

Fig.6 Prediction and validation of the targeting relationship between CASP8 and miR-1260a

Fig.7 Expression levels of miR-1260a and CASP8 in PCOS GCs

References 25

[1]	AZZIZ R. PCOS in 2015:New insights into the genetics of polycystic ovary syndrome[J]. Nat Rev Endocrinol, 2016, 12(3):183. doi:10.1038/nrendo.2016.9.
[2]	ESCOBAR-MORREALE H F. Polycystic ovary syndrome:Definition,aetiology,diagnosis and treatment[J]. Nat Rev Endocrinol, 2018, 14(5):270-284. doi:10.1038/nrendo.2018.24.
[3]	DIAO F Y, XU M, HU Y, et al. The molecular characteristics of polycystic ovary syndrome(PCOS)ovary defined by human ovary cDNA microarray[J]. J Mol Endocrinol, 2004, 33(1):59-72. doi:10.1677/jme.0.0330059.
[4]	BOZDAG G, MUMUSOGLU S, ZENGIN D, et al. The prevalence and phenotypic features of polycystic ovary syndrome:A systematic review and meta-analysis[J]. Hum Reprod, 2016, 31(12):2841-2855. doi:10.1093/humrep/dew218.
[5]	MATSUDA F, INOUE N, MANABE N, et al. Follicular growth and atresia in mammalian ovaries:Regulation by survival and death of granulosa cells[J]. J Reprod Dev, 2012, 58(1):44-50. doi:10.1262/jrd.2011-012.
[6]	ALAM M H, MIYANO T. Interaction between growing oocytes and granulosa cells in vitro[J]. Reprod Med Biol, 2020, 19(1):13-23. doi:10.1002/rmb2.12292.
[7]	ZHAO Y, PAN S, LI Y, et al. Exosomal miR-143-3p derived from follicular fluid promotes granulosa cell apoptosis by targeting BMPR1A in polycystic ovary syndrome[J]. Sci Rep, 2022, 12(1):4359. doi:10.1038/s41598-022-08423-6.
[8]	YOON S Y. Mesenchymal stem cells for restoration of ovarian function[J]. Clin Exp Reprod Med, 2019, 46(1):1-7. doi:10.5653/cerm.2019.46.1.1.
[9]	ESFANDYARI S, CHUGH R M, PARK H S, et al. Mesenchymal stem cells as a bio organ for treatment of female infertility[J]. Cells, 2020, 9(10):2253. doi:10.3390/cells9102253.
[10]	XU S, LIU C, JI H L. Concise review:Therapeutic potential of the mesenchymal stem cell derived secretome and extracellular vesicles for radiation-induced lung injury:Progress and hypotheses[J]. Stem Cells Transl Med, 2019, 8(4):344-354. doi:10.1002/sctm.18-0038.
[11]	ZHANG X, YUAN X, SHI H, et al. Exosomes in cancer:Small particle,big player[J]. J Hematol Oncol, 2015, 8:83. doi:10.1186/s13045-015-0181-x.
[12]	O'LOUGHLIN A J, WOFFINDALE C A, WOOD M J. Exosomes and the emerging field of exosome-based gene therapy[J]. Curr Gene Ther, 2012, 12(4):262-274. doi:10.2174/156652312802083594.
[13]	JARRETT B Y, VANDEN BRINK H, OLDFIELD A L, et al. Ultrasound characterization of disordered antral follicle development in women with polycystic ovary syndrome[J]. J Clin Endocrinol Metab, 2020, 105(11):e3847-3861. doi:10.1210/clinem/dgaa515.
[14]	LIU R, ZHANG X, FAN Z, et al. Human amniotic mesenchymal stem cells improve the follicular microenvironment to recover ovarian function in premature ovarian failure mice[J]. Stem Cell Res Ther, 2019, 10(1):299. doi:10.1186/s13287-019-1315-9.
[15]	TAKAHASHI A, YOUSIF A, HONG L, et al. Premature ovarian insufficiency:pathogenesis and therapeutic potential of mesenchymal stem cell[J]. J Mol Med(Berl), 2021, 99(5):637-650. doi:10.1007/s00109-021-02055-5.
[16]	YIN N, ZHAO W, LUO Q, et al. Restoring ovarian function with human placenta-derived mesenchymal stem cells in autoimmune-induced premature ovarian failure mice mediated by treg cells and associated cytokines[J]. Reprod Sci, 2018, 25(7):1073-1082. doi:10.1177/1933719117732156.
[17]	DING C, ZOU Q, WANG F, et al. Human amniotic mesenchymal stem cells improve ovarian function in natural aging through secreting hepatocyte growth factor and epidermal growth factor[J]. Stem Cell Res Ther, 2018, 9(1):55. doi:10.1186/s13287-018-0781-9.
[18]	LING L, FENG X, WEI T, et al. Human amnion-derived mesenchymal stem cell (hAD-MSC) transplantation improves ovarian function in rats with premature ovarian insufficiency(POI)at least partly through a paracrine mechanism[J]. Stem Cell Res Ther, 2019, 10(1):46. doi:10.1186/s13287-019-1136-x.
[19]	KALHORI Z, AZADBAKHT M, SOLEIMANI MEHRANJANI M, et al. Improvement of the folliculogenesis by transplantation of bone marrow mesenchymal stromal cells in mice with induced polycystic ovary syndrome[J]. Cytotherapy, 2018, 20(12):1445-1458. doi:10.1016/j.jcyt.2018.09.005.
[20]	XIE Q, XIONG X, XIAO N, et al. Mesenchymal stem cells alleviate dhea-induced polycystic ovary syndrome (PCOS) by inhibiting inflammation in mice[J]. Stem Cells Int, 2019, 2019:9782373. doi:10.1155/2019/9782373.
[21]	ZHAO Y, PAN S, WU X. Human umbilical cord mesenchymal stem cell-derived exosomes inhibit ovarian granulosa cells inflammatory response through inhibition of NF-κB signaling in polycystic ovary syndrome[J]. J Reprod Immunol, 2022, 152:103638. doi:10.1016/ j.jri.2022.103638.
[22]	SAID R, GARCIA-MAYEA Y, TRABELSI N, et al. Expression patterns and bioinformatic analysis of miR-1260a and miR-1274a in Prostate Cancer Tunisian patients[J]. Mol Biol Rep, 2018, 45(6):2345-2358. doi:10.1007/s11033-018-4399-x.
[23]	PARK S, KIM J, CHO Y, et al. Promotion of tumorigenesis by miR-1260b-targeting CASP8:Potential diagnostic and prognostic marker for breast cancer[J]. Cancer Sci, 2022, 113(6):2097-2108. doi:10.1111/cas.15345.
[24]	LI X, ZHANG Y, WANG N, et al. CircRNA.0007127 triggers apoptosis through the miR-513a-5p/CASP8 axis in K-562 cells[J]. J Zhejiang Univ Sci B, 2022, 23(9):732-746. doi:10.1631/jzus.B2200048.
[25]	HONNMA H, ENDO T, HENMI H, et al. Altered expression of Fas/Fas ligand/caspase 8 and membrane type 1-matrix metalloproteinase in atretic follicles within dehydroepiandrosterone-induced polycystic ovaries in rats[J]. Apoptosis, 2006, 11(9):1525-1533. doi:10.1007/s10495-006-9148-2.