Construction of airway organoid microinjection and polarity reversal model

doi:10.11958/20231469

Abstract

Abstract:

Objective To explore novel methods for efficient respiratory viral infection of organoids by microinjection and polarity inversion techniques. Methods Lung tissue samples were obtained from 8-week-old male C57BL/6 mouse, and respiratory epithelial cells were extracted to establish a transwell organoid culture model. The green fluorescent protein (GFP) labeled influenza virus PR8 (GFP-PR8) was quantitatively injected into organoids by improving the traditional microinjection platform, and morphologic changes in organoids and the immunofluorescence staining characteristics of tight junction proteins and microtubule proteins were observed. Polarity inversion apical-out (AO) was induced by suspension culture, and the morphological characteristics of polarity inversion was determined by HE staining. Normal and inverted organoids were infected with PR8, and the infection efficiency and expression differences of key pathway genes under different virus concentrations were observed. Results Ordinary organoids showed a significant increase in volume after microinjection. Following PR8 injection, the efficiency of infection was significantly higher in the apical region of organoids, accompanied by noticeable damage, as evidenced by significant down-regulation of tight junction proteins and microtubule protein expression. After suspension culture of the organoids, the polarity of ciliated cells gradually inverted outward over time, and the proportion of AO organoids stabilized on the 6th day. The efficiency of viral infection significantly increased in the inverted organoids, accompanied by significant cellular damage. After PR8 infection at 0.01 MOI, AO organoids showed significant changes in the inflammatory pathway and differentiation-related genes, with the opposite trend observed after higher concentration of PR8 infection. Conclusion Both polarity inversion and microinjection techniques significantly enhance the efficiency of influenza virus infection in organoids, thereby facilitating organoid widespread application in the field of respiratory tract infections.

Key words: organoids, microinjections, respirovirus infections, apical-out, airway organoid

CLC Number:

R318.1

Figures/Tables 11

Tab.1 Primer sequences for qPCR

基因名称	引物序列（5′→3′）	产物大小/bp
GAPDH	上游：TGTGTCCGTCGTGGATCTGA	150
	下游：TTGCTGTTGAAGTCGCAGGAG	150
CCL2	上游：TCAGGCAGATGCAGTTAACG	117
	下游：TCTTTGGGACACCTGCTGC	117
IL-1β	上游：ACCTAGCTGTCAACGTGTGG	133
	下游：TCAAAGCAATGTGCTGGTGC	133
SCGB1A1	上游：ATGAAGATCGCCATCACAATCAC	135
	下游：GGATGCCACATAACCAGACTCT	135
SCGB3A2	上游：ACAGGGAGACGGTTGATGAG	140
	下游：GTTGGGCTTTCTGACTGCAT	140
MUC5B	上游：TCCCTAGCATGAGCGCCTTA	178
	下游：CCACGACGCAGTTGGATGTT	178
FOXJ1	上游：CCCTGACGACGTGGACTATG	114
	下游：GCCGACAGAGTGATCTTGGT	114

Fig.1 Morphological characteristics after microinjection of FITC-dextran in organoid

Fig.2 Observation of organoid imaging characteristics under a fluorescence microscope after microinjection

Fig.3 Expression characteristics of specific proteins in organoids after microinjection of GFP-PR8 (immunofluorescence staining)

Fig.4 Expression characteristics of specific proteins in organoids after microinjection of GFP-PR8 (HE staining, ×400)

Fig.5 Morphological comparition of AI and AO organoids (HE staining)

Fig.6 The proportion of organoids with polarity reversal in the upper chamber of transwell to the total population of organoids

Fig.7 Morphological characteristics of organoids under different culture conditions (×100)

Fig.8 Characteristics of organoidafter infection with GFP-PR8 (×100)

Fig.9 Morphological characteristics of AO organoids infected by PR8 (HE staining)

Fig.10 Gene expression characteristics in AI and AO organoids after stimulation with different virus concentrations

References 21

[1]	WANG J, LI X, CHEN H. Organoid models in lung regeneration and cancer[J]. Cancer Lett, 2020, 475:129-135. doi:10.1016/j.canlet.2020.01.030.
[2]	ZHOU J, LI C, SACHS N, et al. Differentiated human airway organoids to assess infectivity of emerging influenza virus[J]. Proc Natl Acad Sci U S A, 2018, 115(26):6822-6827. doi:10.1073/pnas.1806308115.
[3]	ZHAO F, MA Q, YUE Q, et al. SARS-CoV-2 Infection and lung regeneration[J]. Clin Microbiol Rev, 2022, 35(2):e0018821. doi:10.1128/cmr.00188-21.
[4]	CO J Y, MARGALEF-CATALÀ M, MONACK D M, et al. Controlling the polarity of human gastrointestinal organoids to investigate epithelial biology and infectious diseases[J]. Nat Protoc, 2021, 16(11):5171-5192. doi:10.1038/s41596-021-00607-0.
[5]	STROULIOS G, BROWN T, MORENI G, et al. Apical-out airway organoids as a platform for studying viral infections and screening for antiviral drugs[J]. Sci Rep, 2022, 12(1):7673. doi:10.1038/s41598-022-11700-z.
[6]	CHIU M C, ZHANG S, LI C, et al. Apical-out human airway organoids modeling SARS-CoV-2 Infection[J]. Viruses, 2023, 15(5):1166. doi:10.3390/v15051166.
[7]	LI K, ZHANG Q, LI L, et al. DJ-1 governs airway progenitor cell/eosinophil interactions to promote allergic inflammation[J]. J Allergy Clin Immunol, 2022, 150(5):1178-1193.e13. doi:10.1016/j.jaci.2022.03.036.
[8]	CHEN X, ZHANG C, WEI T, et al. α7nAChR activation in AT2 cells promotes alveolar regeneration through WNT7B signaling in acute lung injury[J]. JCI Insight, 2023, 8(15):e162547. doi:10.1172/jci.insight.162547.
[9]	LIN X, LI Y, GONG L, et al. Tempo-spatial regulation of the Wnt pathway by FAM13A modulates the stemness of alveolar epithelial progenitors[J]. EBioMedicine, 2021, 69:103463. doi:10.1016/j.ebiom.2021.103463.
[10]	CHANDA D, REHAN M, SMITH S R, et al. Mesenchymal stromal cell aging impairs the self-organizing capacity of lung alveolar epithelial stem cells[J]. Elife, 2021, 10:e68049. doi:10.7554/eLife.68049.
[11]	LI Y, ZHANG Q, LI L, et al. LKB1 deficiency upregulates RELM-α to drive airway goblet cell metaplasia[J]. Cell Mol Life Sci, 2021, 79(1):42. doi:10.1007/s00018-021-04044-w.
[12]	CHEN H, MATSUMOTO K, BROCKWAY B L, et al. Airway epithelial progenitors are region specific and show differential responses to bleomycin-induced lung injury[J]. Stem Cells, 2012, 30(9):1948-1960. doi:10.1002/stem.1150.
[13]	SHAO H, QIN Z, GENG B, et al. Impaired lung regeneration after SARS-CoV-2 infection[J]. Cell Prolif, 2020, 53(12):e12927. doi:10.1111/cpr.12927.
[14]	EKANGER C T, ZHOU F, BOHAN D, et al. Human organotypic airway and lung organoid cells of bronchiolar and alveolar differentiation are permissive to infection by influenza and SARS-CoV-2 respiratory virus[J]. Front Cell Infect Microbiol, 2022, 12:841447. doi:10.3389/fcimb.2022.841447.
[15]	PRAENA B, WAN X F. Influenza virus infections in polarized cells[J]. Viruses, 2022, 14(6):1307. doi:10.3390/v14061307.
[16]	STROULIOS G, BROWN T, KONDRO D, et al. An apical-out airway organoid model to study viral infections and assess antiviral drug effects[J]. Eur Respir J, 2022, 60(suppl 66):4358. doi:10.1183/13993003.congress-2022.4358.
[17]	CO J Y, MARGALEF-CATALÀ M, LI X, et al. Controlling Epithelial Polarity:a human enteroid model for host-pathogen interactions[J]. Cell Rep, 2019, 26(9):2509-2520.e4. doi:10.1016/j.celrep.2019.01.108.
[18]	WIJESEKARA P, PATEL K Z, OTTO E L, et al. Protocol to engineer apical-out airway organoids using suspension culture of human airway basal stem cell aggregates[J]. STAR Protoc, 2023, 4(2):102154. doi:10.1016/j.xpro.2023.102154.
[19]	WILSON S S, TOCCHI A, HOLLY M K, et al. A small intestinal organoid model of non-invasive enteric pathogen-epithelial cell interactions[J]. Mucosal Immunol, 2015, 8(2):352-361. doi:10.1038/mi.2014.72.
[20]	VAZQUEZ-ARMENDARIZ A I, HEINER M, EL AGHA E, et al. Multilineage murine stem cells generate complex organoids to model distal lung development and disease[J]. EMBO J, 2020, 39(21):e103476. doi:10.15252/embj.2019103476.
[21]	WILLIAMSON I A, ARNOLD J W, SAMSA L A, et al. A high-throughput organoid microinjection platform to study gastrointestinal microbiota and luminal physiology[J]. Cell Mol Gastroenterol Hepatol, 2018, 6(3):301-319. doi:10.1016/j.jcmgh.2018.05.004.