Molecular mechanism study of melanoma cell proliferation regulated by miR-101-3p-E2F2 targeting pathway

doi:10.11958/20212787

Abstract

Abstract:

Objective To explore effect and mechanism of miR-101-3p targeting E2F transcription factor 2 (E2F2) in regulating the melanoma cell proliferation. Methods GEPIA, OSskcm databases were used to analyze the expression of E2F2 in melanoma and evaluate the value of transcription factor E2F2 in the prognosis of melanoma. The expression of E2F2 in melanoma cells MV3 was inhibited by shRNA, and the cell cycle changes were detected by PI staining flow cytometry. The expression levels of CyclinE and Cyclin-dependent kinase 2 (CDK2) were detected by Western blot assay. The expression level of autophagy-associated protein LC3B was detected by immunofluorescence, and the growth changes of melanoma in vivo were observed by tumor-bearing experiments in nude mice. The expression level of miR-101-3p in MV3 cells was detected by real-time fluorescence quantitative PCR, the expression level of E2F2 was detected by qPCR and Western blot assay, and the proliferation level of MV3 cells was detected by MTT and BrdU methods. Results Melanoma patients with increased E2F2 expression had worse prognosis (P<0.05). Compared with the shGFP group, the proportion of cells in G0/G1 phase increased significantly in the shE2F2 group (P<0.05), the expression levels of CyclinE and CDK2 decreased significantly, the fluorescence signal of autophagy-associated protein LC3B decreased significantly (P<0.05), and the weight of melanoma formation in vivo decreased significantly (P<0.05). The expression level of miR-101-3p in MV3 cells increased significantly after treated with miR-101-3p mimics (P<0.05), and the mRNA and protein expression of E2F2 were significantly lower than those in the NC mimics treatment group (P<0.05). Meanwhile, MTT results showed that the vitality of MV3 cells decreased significantly in the miR-101-3p mimics group (P<0.05). BrdU labeling test results showed that the BrdU positive signal decreased significantly in the miR-101-3p mimics group (P<0.05). Conclusion miR-101-3p targets to E2F2 and inhibits its expression, and then reduces the proliferation level of melanoma cells.

Key words: melanoma, E2F2 transcription factor, cell proliferation, miR-101-3p

CLC Number:

R739.5

Figures/Tables 13

Tab.1 Primer sequence for qPCR

基因名称	引物序列（5′→3′）	产物大小（bp）
miR-101-3p	上游：TACAGTACTGTGATAACTGAA 下游：GGAGTAG ATGATGGTTAGC	58
U6	上游：CTCGCTTCGGCAGCACA 下游：AACGCTTCACGAATTTGCGT	94
E2F2	上游：CTCTCTGAGCTTCAAGCACCTG 下游：CTTGACGGCAATCACT GTCTGC	118
GAPDH	上游：ACCACAGTCCATGCCATCAC 下游：TCCACCACCCTGTTGCTGTA	452

Fig.1 Survival curves of melanoma patients with different expression levels of E2F2

Fig.2 CancerSEA database analyzes the functional diagram of E2F2 in melanoma

Fig.3 The changes of cell cycle detected by PI staining flow cytometry after shGFP or shE2F2 treatment

Fig.4 The effect shGFP or shE2F2 on cell viability of MV3 cells detected by MTT

Fig.5 Expression of cycle-related proteins in MV3 cells treated with shGFP or shE2F2

Fig.6 Expression changes of p-AKT, AKT and p21 in MV3 cells treated with shGFP or shE2F2

Fig.7 The changes of LC3B fluorescence signal of MV3 cells after shGFP or shE2F2 treatment

Fig.8 The effect of shE2F2 on the growth of melanoma in vivo

Fig.9 The binding sequence diagram between miR-101 and the 3'-UTR sequence of E2F2 predicted by StarBase

Fig.10 Protein expression levels of E2F2 in MV3 cells treated with NC or miR-101-3p mimics

Tab.2 Comparison of MV3 cell viability after treatment with NC mimics and miR-101-3p mimics between the two groups

组别	1 d	2 d	3 d	4 d	5 d
NC mimics组	0.18±0.02	0.38±0.03	0.74±0.05	1.11±0.16	1.90±0.05
miR-101-3p mimics组	0.19±0.02	0.36±0.03	0.68±0.04	0.87±0.08	1.26±0.12
t	0.692	0.711	1.779	2.336	8.784^＊＊

Fig.11 BrdU positive staining in MV3 cells treated with NC mimics or miR-101-3p mimics

References 20

[1]	SCHADENDORF D, VAN AKKOOI A C J, BERKING C, et al. Melanoma[J]. Lancet, 2018, 392(10151):971-984. doi:10.1016/S0140-6736(18)31559-9.
[2]	AUDRITO V, MANAGÒ A, GAUDINO F, et al. Targeting metabolic reprogramming in metastatic melanoma: The key role of nicotinamide phosphoribosyltransferase (NAMPT)[J]. Semin Cell Dev Biol, 2020, 98:192-201. doi:10.1016/j.semcdb.2019.05.001.
[3]	ZHAO G, GREEN C F, HUI Y H, et al. Discovery of a highly selective NAMPT inhibitor that demonstrates robust efficacy and improved retinal toxicity with nicotinic acid coadministration[J]. Mol Cancer Ther, 2017, 16(12):2677-2688. doi:10.1158/1535-7163.MCT-16-0674.
[4]	LIANG B, ZHAO J, WANG X. Clinical performance of E2Fs1-3 in kidney clear cell renal cancer,evidence from bioinformatics analysis[J]. Genes Cancer, 2017, 8(5/6):600-607. doi:10.18632/genes andcancer.143.
[5]	AN X, MA H, LIU Y, et al. Effects of miR-101-3p on goat granulosa cells in vitro and ovarian development in vivo via STC1[J]. J Anim Sci Biotechnol, 2020, 11:102. doi:10.1186/s40104-020-00506-6.
[6]	VAN ZEIJL M C, WAN DEN EERTWEGH A J, HAANEN J B, et al. (Neo)adjuvant systemic therapy for melanoma[J]. Eur J Surg Oncol, 2017, 43(3):534-543. doi:10.1016/j.ejso.2016.07.001.
[7]	GOODY D, GUPTA S K, ENGELMANN D, et al. Drug repositioning inferred from E2F1-coregulator interactions studies for the prevention and treatment of metastatic cancers[J]. Theranostics, 2019, 9(5):1490-1509. doi:10.7150/thno.29546.
[8]	ZHAO H, TANG W, CHEN X, et al. The NAMPT/E2F2/SIRT1 axis promotes proliferation and inhibits p53-dependent apoptosis in human melanoma cells[J]. Biochem Biophys Res Commun, 2017, 493(1):77-84. doi:10.1016/j.bbrc.2017.09.071.
[9]	ZENG Z, CAO Z, TANG Y. Increased E2F2 predicts poor prognosis in patients with HCC based on TCGA data[J]. BMC Cancer, 2020, 20(1):1037. doi:10.1186/s12885-020-07529-2.
[10]	HUANG Y L, NING G, CHEN L B, et al. Promising diagnostic and prognostic value of E2Fs in human hepatocellular carcinoma[J]. Cancer Manag Res, 2019, 11:1725-1740. doi:10.2147/CMAR.S182001.
[11]	SUN C C, LI S J, HU W, et al. Comprehensive analysis of the expression and prognosis for E2Fs in human breast cancer[J]. Mol Ther, 2019, 27(6):1153-1165. doi:10.1016/j.ymthe.2019.03.019.
[12]	YANG C, ZHANG Z C, LIU T B, et al. E2F1/2/7/8 as independent indicators of survival in patients with cervical squamous cell carcinoma[J]. Cancer Cell Int, 2020, 20:500. doi:10.1186/s12935-020- 01594-0.
[13]	LIU X, HU C. Novel potential therapeutic target for E2F1 and prognostic factors of E2F1/2/3 /5/7/8 in human gastric cancer[J]. Mol Ther Methods Clin Dev, 2020, 18:824-838. doi:10.1016/j.omtm.2020.07.017.
[14]	GAO J, CHEN X, SHAN C, et al. Autophagy in cardiovascular diseases: role of noncoding RNAs[J]. Mol Ther Nucleic Acids, 2020, 23:101-118. doi:10.1016/j.omtn.2020.10.039.
[15]	YAN X, ZHOU R, MA Z. Autophagy-cell survival and death[J]. Adv Exp Med Biol, 2019, 1206:667-696. doi:10.1007/978-981-15-0602-4_29.
[16]	CUI G, WANG H, LIU W, et al. Glycogen phosphorylase B is regulated by miR101-3p and promotes hepatocellular carcinoma tumorigenesis[J]. Front Cell Dev Biol, 2020, 8:566494. doi:10.3389/fcell.2020.566494.
[17]	HUANG Z, WU X, LI J. miR-101 suppresses colon cancer cell migration through regulation of EZH2[J]. Rev Esp Enferm Dig, 2021, 113(4):255-260. doi:10.17235/reed.2020.6800/2019.
[18]	WU R S, QIU E H, ZHU J J, et al. MiR-101 promotes nasopharyngeal carcinoma cell apoptosis through inhibiting Ras/Raf/MEK/ERK signaling pathway[J]. Eur Rev Med Pharmacol Sci, 2020, 24(16):8240. doi:10.26355/eurrev_202008_22580.
[19]	HUANG Y, ZOU Y, LIN L, et al. miR-101 regulates cell proliferation and apoptosis by targeting KDM1A in diffuse large B cell lymphoma[J]. Cancer Manag Res, 2019, 11:2739-2746. doi:10.2147/CMAR.S197744.
[20]	WANDLER A, RIBER-HANSEN R, HAGER H, et al. Quantification of microRNA-21 and microRNA- 125b in melanoma tissue[J]. Melanoma Res, 2017, 27(5):417-428. doi:10.1097/CMR.0000000000000374.